Isolation and Molecular Identification of Yeast Strains Causing Spoilage in Labneh Cheese

Özgür Kebabcı

doi:10.17776/csj.1584801

TR EN

Isolation and Molecular Identification of Yeast Strains Causing Spoilage in Labneh Cheese

Abstract

Labneh is among the dairy products with high nutritional value in the spreadable cheese category. It is consumed together with other dairy products in domestic food consumption. It has been observed that labneh cheese purchased for consumption spoils in the refrigerator after a while. Samples taken from spoiled labneh cheese were purified by single colony cultivation method (streak-plate technique) in PDA and then purified yeast strains were identified. EurX GeneMATRIX Plant & Fungi DNA isolation kit (Poland) was used for DNA isolation in the identification. The amount and purity of the isolated DNA were measured spectrophotometrically in Thermo Scientific Nanodrop 2000 (USA). For species determination, targeted gene regions were amplified by PCR with universal primers ITS1 (5' TCCGTAGGTGAACCTGCGG 3') and ITS4 (5' TCCTCCGCTTATTGATATGC 3'). A single-step PCR process was performed to amplify the region of approximately 700 bases. The amplification results obtained by PCR were electrophoresed in 1.5% agarose gel prepared with 1x TAE buffer at 100 volts for 90 minutes and images were taken under UV light using ethidium bromide dye. The results obtained with ITS1 and ITS4 primers were evaluated using the CAP contig assembly algorithm in BioEdit software to create a consensus sequence. Species determination of yeast isolates was determined according to the closest species in NCBI. One of the two yeast species isolated from spoiled labneh cheese was identified as Yarrowia lipolytica with a similarity rate of 99.06% and the other as Rhodotorula mucilaginosa with a similarity rate of 98.42%. Evolutionary analyses were performed in MEGA11 and the evolutionary distance between the two newly isolated species was shown.

Keywords

References

[1] Quintieri L., Koo O.K., and Caleb, O.J., Editorial: Fight against food waste: combating contamination and spoilage, Front. Microbiol., 14 (2023) 1265477.
[2] Scott V.N., Interaction of Factors to Control Microbial Spoilage of Refrigerated Foods, J. Food Prot., 52(6) (1989) 431-435.
[3] Rawat S., Food Spoilage: Microorganisms and their prevention, Asian J. Plant Sci., 5(4) (2015) 47-56.
[4] Abdullahi A.A., Bala J.D., Kuta F.A., Adabara N.U., Liyasu U.S., and Aliu M.O., Microbial Spoilage of Food In Industry: A Review, FUW Trends in Science & Technology Journal, 4(2) (2019) 519-523.
[5] Snyder A.B., and Worobo R.W., Fungal Spoilage In Food Processing, J. Food Prot., 81(6) (2018) 1035-1040.
[6] Moss M.O., General characteristics of moulds, In: Clive de W. Blackburn (Eds). Food spoilage microorganisms, Woodhead Publishing Ltd, England, (2006) 401-414.
[7] Modi H.A., An Introduction to Microbial Spoilage of Foods, In: Modi H. A. (Eds). Microbial Spoilage of Foods, Aavishkar Publishers, Distributors, Jaipur, India, (2009) 43-66.
[8] Erten H., Agirman B., Boyaci-Gunduz C.P., Carsanba E., and Leventdurur S., Natural Microflora of Different Types of Foods, In: Malik A., Erginkaya Z., and Erten H., (Eds). Health and Safety Aspects of Food Processing Technologies, Springer Nature, Switzerland, (2019) 51-94.

[9] Boor K., and Fromm H., Managing microbial spoilage in the dairy industry, In: Clive de W. Blackburn (Eds). Food spoilage microorganisms, Woodhead Publishing Ltd, England, (2006) 171-193.
[10] Kurtzman C.P., Detection, identification and enumeration methods for spoilage yeasts, In: Clive de W. Blackburn (Eds). Food spoilage microorganisms, Woodhead Publishing Ltd, England, (2006) 28-54.
[11] Büyükkiraz M.E., Avcı E., Kahraman N., and Kesmen Z., Bazı Gıdalardaki Bozulma Etkeni Maya Türlerinin İzolasyonu ve Tanımlanması, (Identification of Spoilage Yeasts Isolated From Some Foods), Çukurova J. Agric. Food Sci., 35(1) (2020) 15-28.
[12] Liu K-F., Li X-H., and Hui F-L., Yarrowia brassicae f.a., sp. nov., a new yeast species from traditional Chinese sauerkraut, Int. J. Syst. Evol. Microbiol., 68(6) (2018) 2024-2027.
[13] Nagy E., Niss M., Dlauchy D., Arneborg N., Nielsen D.S., and Péter G., Yarrowia divulgata f.a., sp. nov., a yeast species from animal-related and marine sources, Int. J. Syst. Evol. Microbiol., 63(12) (2013) 4818-4823.
[14] Stratford M., Food and Beverage Spoilage Yeasts. In: Querol A. and Fleet G. (Eds). Yeasts in food and beverages, Springer Berlin Heidelberg, (2006) 335-379.
[15] Hernández A., Pérez-Nevado F., Ruiz-Moyano S., Serradilla M.J., Villalobos M.C., Martín A., Córdoba M.G., Spoilage yeasts: What are the sources of contamination of foods and beverages?, Int. J. Food Microbiol., 286 (2018) 98-110.
[16] Cocolin L., Rantsiou K., Iacumin L., Zironi R., Comi G., Molecular detection and identification of Brettanomyces/Dekkera bruxellensis and Brettanomyces/Dekkera anomalus in spoiled wines, Appl. Environ. Microbiol., 70(3) (2004) 1347-1355.
[17] Pham T., Wimalasena T., Box W.G., Koivuranta K., Storgårds E., Smart K.A., Gibson B.R., Evaluation of ITS PCR and RFLP for differentiation and identification of brewing yeast and brewery ‘wild’ yeast contaminants, J. Inst. Brew., 117(4) (2011) 556-568.
[18] Caputo L., Quintieri L., Baruzzi F., Borcakli M., Morea M., Molecular and phenotypic characterization of Pichia fermentans strains found among Boza yeasts, Food Res. Int., 48(2) (2012) 755-762.
[19] Ceugniez A., Drider D., Jacques P., Coucheney F., Yeast diversity in a traditional French cheese “Tomme d'orchies” reveals infrequent and frequent species with associated benefits, Food Microbiol., 52 (2015) 177-184.
[20] Corte L., di Cagno R., Groenewald M., Roscini L., Colabella C., Gobbetti M., Cardinali G., Phenotypic and molecular diversity of Meyerozyma guilliermondii strains isolated from food and other environmental niches, hints for an incipient speciation, Food Microbiol., 48 (2015) 206-215.
[21] Pereira E.L., Ramalhosa E., Borges A., Pereira J.A., Baptista P., Yeast dynamics during the natural fermentation process of table olives (Negrinha de Freixo cv.), Food Microbiol., 46 (2015) 582-586.
[22] Bayazıt G., Gül Ü.D., Taştan B.E., Tozoğlu F., Gurbanov R., Exploring the biotechnological prospects of a recently discovered fungus isolated from marine mucilage, Biomass Conv. Bioref., (2024).
[23] White T., Bruns T.D., Lee S., Taylor J., Amplification and Direct Sequencing of Fungal Ribosomal RNA Genes for Phylogenetics, PCR Protocols, 18 (1990) 315-322.
[24] Gardes M., and Bruns T.D., ITS primers with enhanced specificity for basidiomycetes - Application to the identification of mycorrhizae and rusts, Mol. Ecol., 2 (1993) 113-118.
[25] Janowski D., Wilgan R., Leski T., Karliński L., Rudawska M., Effective Molecular Identification of Ectomycorrhizal Fungi: Revisiting DNA Isolation Methods, Forests, 10(3) (2019) 218.
[26] Tamura K., and Nei M., Estimation of the number of nucleotide substitutions in the control region of mitochondrial DNA in humans and chimpanzees, Mol. Biol. Evol., 10(3) (1993) 512-526.
[27] Tamura K., Stecher G., and Kumar S., MEGA 11: Molecular Evolutionary Genetics Analysis Version 11, Mol. Biol. Evol., 38(7) (2021) 3022-3027.
[28] Viljoen B.C., The ecological diversity of yeasts in dairy products. In: Jakobsen et al. (Eds), Yeasts in the Dairy Industry: Positive and Negative Aspects, Brussels, IDF, (1998) 70-77.
[29] Frohlich-Wyder M.T., Yeasts in dairy products, In: Yeasts in Food Beneficial and Detrimental Aspects, Boekhout T.A., and Robert V. (Eds), Behr’s-Verlag, Hamburg, (2003) 209-237.
[30] Prillinger H., Molnár O., Eliskases-Lechner F., Lopandic K., Phenotypic and genotypic identification of yeasts from cheese, Antonie van Leeuwenhoek, 75(4) (1999) 267-283.
[31] Westall S., and Filtenborg O., Spoilage yeasts of decorated soft cheese packed in modified atmosphere, Food Microbiol., 15(2) (1998) 243-249.
[32] Tokak S., Kılıç İ.H., Yalçın H.T., and Duran T., Detection of Extracellular Lipases and Genotypic Identification from Yeast Causing Spoilage of Some Dairy Products Produced in Gaziantep, KSU J. Agric. Nat., 22(1) (2019) 206-211.
[33] Budak S.O., Figge M.J., Houbraken J., de Vries R.P., The diversity and evolution of microbiota in traditional Turkish Divle Cave cheese during ripening, Int. Dairy J., 58 (2016) 50-53.
[34] Fröhlich‐Wyder M-T., Arias‐Roth E., and Jakob E., Cheese yeasts, Yeast, 36(3) (2018) 129-141.
[35] Milanović V., Sabbatini R., Garofalo C., Cardinali F., Pasquini M., Aquilanti L., and Osimani A., Evaluation of the inhibitory activity of essential oils against spoilage yeasts and their potential application in yogurt, Int. J. Food Microbiol., 341 (2021) 109048.
[36] Las Heras-Vazquez F.J., Mingorance-Cazorla L., Clemente-Jimenez J.M., and Rodriguez-Vico F., Identification of yeast species from orange fruit and juice by RFLP and sequence analysis of the 5.8S rRNA gene and the two internal transcribed spacers, FEMS Yeast Res., 3 (2003) 3-9.
[37] Mokhtari M., Etebarian H.R., Razavi M., Heydari A. and Mirhendi H., Identification of Yeasts Isolated from Varieties of Apples and Citrus Using PCR-Fragment Size Polymorphism and Sequencing of ITS1–5.8S-ITS2 region, Food Biotechnol., 26(3) (2012) 252-265.
[38] Šovljanski O, Saveljić A., Tomić A., Šeregelj V., Lončar B., Cvetković D., Ranitović A., Pezo L., Ćetković G., Markov S., and Čanadanović-Brunet J., Carotenoid-Producing Yeasts: Selection of the Best-Performing Strain and the Total Carotenoid Extraction Procedure, Processes, 10(9) (2022) 1699.
[39] Gavião, E. R., Munieweg, F. R., Czarnobay, M., Dilda, A., Stefani, L. M., and Nespolo, C. R. (2021). Development and characterization of two novel formulations of Labneh cheese of sheep’s milk, Food Sci. Technol., Campinas, 41(3) (2021) 708-715.
[40] Tawfek M.A., Farahar E.S.A., and Shalaby S.M., Effectiveness of Myrrh Oil In Improving The Quality and Shelf Life of Labneh, Egypt. J. Dairy Sci., 46(1) (2018) 79-87.

Details

Primary Language

English

Subjects

Phylogeny and Comparative Analysis , Mycology

Journal Section

Research Article

Authors

Özgür Kebabcı ^*
0000-0002-9404-747X
Türkiye

Publication Date

June 30, 2025

Submission Date

November 13, 2024

Acceptance Date

March 17, 2025

Published in Issue

Year 2025 Volume: 46 Number: 2

DOI

https://doi.org/10.17776/csj.1584801

IZ

https://izlik.org/JA55KP78MF

Cite

RIS / Bibtex

APA

Kebabcı, Ö. (2025). Isolation and Molecular Identification of Yeast Strains Causing Spoilage in Labneh Cheese. Cumhuriyet Science Journal, 46(2), 195-200. https://doi.org/10.17776/csj.1584801

Isolation and Molecular Identification of Yeast Strains Causing Spoilage in Labneh Cheese

Labne Peynirinde Bozulmaya Yol Açan Maya Suşlarının İzolasyonu ve Moleküler Tanımlanması

Öz

Anahtar Kelimeler

Isolation and Molecular Identification of Yeast Strains Causing Spoilage in Labneh Cheese

Abstract

Keywords

References

Details

Primary Language

Subjects

Journal Section

Authors

Publication Date

Submission Date

Acceptance Date

Published in Issue

DOI

IZ

Cite